Simple sequence analysis
This code finds mirrors into a sequence string. It takes as parameter one start and one end.
1
Starting code
This is the PHP code used by this example.
1 2 3 4 5 6 7 8 9 10 11 12 | public function sequenceanalysis(SequenceInterface $sequenceManager) { $oSequence = new Sequence(); $oSequence->setSequence("AGGGAATTAAGTAAATGGTAGTGG"); $sequenceManager->setSequence($oSequence); $aMirrors = $sequenceManager->findMirror(null, 6, 8, "E"); return $this->render('default/sequenceanalysis.html.twig', array('mirrors' => $aMirrors) ); } |
2
Result
Result returned by BioPHP for the demonstration data.
Mirrors found
- 6 :
- 0 :
- 0 : AATTAA
- 1 : 4
- 1 :
- 0 : ATGGTA
- 1 : 14
- 0 :
- 8 :
- 0 :
- 0 : GAATTAAG
- 1 : 3
- 0 :
The code above is the one actually executed by this page. Find the other examples in the left-hand column, or the tools in BioTools.