FASTA Alignment


Sample code :


/**
 * @param SequenceAlignmentInterface $sequenceAlignmentManager
 * @return Response
 */
public function fastaseqalignment(SequenceAlignmentInterface $sequenceAlignmentManager)
{
    $sequenceAlignmentManager->setFilename("data/fasta-2.txt");
    $sequenceAlignmentManager->setFormat("FASTA");
    $sequenceAlignmentManager->parseFile();
 
    return $this->render('default/parseseqalignment.html.twig',
        ['sequences' => $sequenceAlignmentManager->getSeqSet()]
    );
}

Result :

ArrayIterator {#611
  flag::STD_PROP_LIST: false
  flag::ARRAY_AS_PROPS: false
  storage: array:2 [
    0 => Amelaye\BioPHP\Domain\Sequence\Entity\Sequence {#648
      -primAcc: 0
      -entryName: null
      -seqLength: 1231
      -start: null
      -end: null
      -molType: null
      -date: null
      -source: null
      -sequence: "GGCAGATTCCCCCTAGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCCCAGAGGGTATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCAGCGCAGCCACCGAGACACCATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGAGTGCCCCCACCTCCCCTCAGGCCGCATTGCAGTGGGGGCTGAGAGGAGGAAGCACCATGGCCCACCTCTTCTCACCCCTTTGGCTGGCAGTCCCTTTGCAGTCTAACCACCTTGTTGCAGGCTCAATCCATTTGCCCCAGCTCTGCCCTTGCAGAGGGAGAGGAGGGAAGAGCAAGCTGCCCGAGACGCAGGGGAAGGAGGATGAGGGCCCTGGGGATGAGCTGGGGTGAACCAGGCTCCCTTTCCTTTGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGGTATGAGGATGGACCTGATGGGTTCCTGGACCCTCCCCTCTCACCCTGGTCCCTCAGTCTCATTCCCCCACTCCTGCCACCTCCTGTCTGGCCATCAGGAAGGCCAGCCTGCTCCCCACCTGATCCTCCCAAACCCAGAGCCACCTGATGCCTGCCCCTCTGCTCCACAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGGTGAGAGAAAAGGCAGAGCTGGGCCAAGGCCCTGCCTCTCCGGGATGGTCTGTGGGGGAGCTGCAGCAGGGAGTGGCCTCTCTGGGTTGTGGTGGGGGTACAGGCAGCCTGCCCTGGTGGGCACCCTGGAGCCCCATGTGTAGGGAGAGGAGGGATGGGCATTTTGCACGGGGGCTGATGCCACCACGTCGGGTGTCTCAGAGCCCCAGTCCCCTACCCGGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGAGGCCTATCGGCGCTTCTACGGCCCGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTGCTCCTCTCCAGGCACCCTTCTTTCCTCTTCCCCTTGCCCTTGCCCTGACCTCCCAGCCCTATGGATGTGGGGTCCCCATCATCCCAGCTGCTCCCAAATAAACTCCAGAAG"
      -description: null
      -organism: null
      -fragment: null
    }
    1 => Amelaye\BioPHP\Domain\Sequence\Entity\Sequence {#646
      -primAcc: 0
      -entryName: null
      -seqLength: 2251
      -start: null
      -end: null
      -molType: null
      -date: null
      -source: null
      -sequence: "GGCAGATTCCCCCTAGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCCCAGAGGGTATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCAGCGCAGCCACCGAGACACCATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGAGTGCCCCCACCTCCCCTCAGGCCGCATTGCAGTGGGGGCTGAGAGGAGGAAGCACCATGGCCCACCTCTTCTCACCCCTTTGGCTGGCAGTCCCTTTGCAGTCTAACCACCTTGTTGCAGGCTCAATCCATTTGCCCCAGCTCTGCCCTTGCAGAGGGAGAGGAGGGAAGAGCAAGCTGCCCGAGACGCAGGGGAAGGAGGATGAGGGCCCTGGGGATGAGCTGGGGTGAACCAGGCTCCCTTTCCTTTGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGGTATGAGGATGGACCTGATGGGTTCCTGGACCCTCCCCTCTCACCCTGGTCCCTCAGTCTCATTCCCCCACTCCTGCCACCTCCTGTCTGGCCATCAGGAAGGCCAGCCTGCTCCCCACCTGATCCTCCCAAACCCAGAGCCACCTGATGCCTGCCCCTCTGCTCCACAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGGTGAGAGAAAAGGCAGAGCTGGGCCAAGGCCCTGCCTCTCCGGGATGGTCTGTGGGGGAGCTGCAGCAGGGAGTGGCCTCTCTGGGTTGTGGTGGGGGTACAGGCAGCCTGCCCTGGTGGGCACCCTGGAGCCCCATGTGTAGGGAGAGGAGGGATGGGCATTTTGCACGGGGGCTGATGCCACCACGTCGGGTGTCTCAGAGCCCCAGTCCCCTACCCGGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGAGGCCTATCGGCGCTTCTACGGCCCGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTGCTCCTCTCCAGGCACCCTTCTTTCCTCTTCCCCTTGCCCTTGCCCTGACCTCCCAGCCCTATGGATGTGGGGTCCCCATCATCCCAGCTGCTCCCAAATAAACTCCAGAAGCCACTGCACTCACCGCACCCGGCCAATTTTTGTGTTTTTAGTAGAGACTAAATACCATATAGTGAACACCTAAGACGGGGGGCCTTGGATCCAGGGCGATTCAGAGGGCCCCGGTCGGAGCTGTCGGAGATTGAGCGCGCGCGGTCCCGGGATCTCCGACGAGGCCCTGGACCCCCGGGCGGCGAAGCTGCGGCGCGGCGCCCCCTGGAGGCCGCGGGACCCCTGGCCGGTCCGCGCAGGCGCAGCGGGGTCGCAGGGCGCGGCGGGTTCCAGCGCGGGGATGGCGCTGTCCGCGGAGGACCGGGCGCTGGTGCGCGCCCTGTGGAAGAAGCTGGGCAGCAACGTCGGCGTCTACACGACAGAGGCCCTGGAAAGGTGCGGCAGGCTGGGCGCCCCCGCCCCCAGGGGCCCTCCCTCCCCAAGCCCCCCGGACGCGCCTCACCCACGTTCCTCTCGCAGGACCTTCCTGGCTTTCCCCGCCACGAAGACCTACTTCTCCCACCTGGACCTGAGCCCCGGCTCCTCACAAGTCAGAGCCCACGGCCAGAAGGTGGCGGACGCGCTGAGCCTCGCCGTGGAGCGCCTGGACGACCTACCCCACGCGCTGTCCGCGCTGAGCCACCTGCACGCGTGCCAGCTGCGAGTGGACCCGGCCAGCTTCCAGGTGAGCGGCTGCCGTGCTGGGCCCCTGTCCCCGGGAGGGCCCCGGCGGGGTGGGTGCGGGGGGCGTGCGGGGCGGGTGCAGGCGAGTGAGCCTTGAGCGCTCGCCGCAGCTCCTGGGCCACTGCCTGCTGGTAACCCTCGCCCGGCACTACCCCGGAGACTTCAGCCCCGCGCTGCAGGCGTCGCTGGACAAGTTCCTGAGCCACGTTATCTCGGCGCTGGTTTCCGAGTACCGCTGAACTGTGGGTGGGTGGCCGCGGGATCCCCAGGCGACCTTCCCCGTGTTTGAGTAAAGCCTCTCCCAGGAGCAGCCTTCTTGCCGTGCTCTCTCGAGGTCAGGACGCGAGAGGAAGGCGC"
      -description: null
      -organism: null
      -fragment: null
    }
  ]
}